>Mlig014003.g4 {REF} Mlig014003.g4 {Length: 3278} {Pfam: Scd6-like Sm domain [PF12701.7, score=92.9]; Ataxin 2 SM domain [PF14438.6, score=28.2]; Transcription factor IIA, alpha/beta subunit [PF03153.13, score=22.3]} {Human: ENSG00000262860, LSM14A, LSM14A, mRNA processing body assembly factor, [Score=121, Expect=5e-29]; ENSG00000257103, LSM14A, LSM14A, mRNA processing body assembly factor, [Score=121, Expect=5e-29]; ENSG00000149657, LSM14B, LSM family member 14B, [Score=115, Expect=6e-28]} {Mouse: ENSMUSG00000066568, Lsm14a, LSM14A mRNA processing body assembly factor, [Score=119, Expect=2e-28]} {Dmel: FBgn0041775, tral, trailer hitch, [RH, Score=102, Expect=2e-22]} {Celegans: WBGene00012484, car-1, Cytokinesis, Apoptosis, RNA-associated, [Score=112, Expect=5e-27]} {Smed: dd_Smed_v6_1125_0_1, dd_Smed_v6_1125_0_1, [Score=117, Expect=3e-28]} {Ipul: Ipul034369.g1, Ipul034369.g1, [Score=112, Expect=4e-26]} {RNA1509_18892, RNA1509_244, RNA1509_55470, RNA1509_6395}
GGATGTCTTACCAGTTTCAACAGTTAAAGCGGAGATAATAGAAAAGCGGAGTTGGGGGAATGTACACACGTGGACTCAAT
GTGCATAGCGTGGCCCAGCCAATAGGAGCGCAGTGAATAAAGTGATGGTCACAATTTAGACACTCCGCGGGGGTAGGGGT
GGAATCTATGTATACTTTATCTATGCTTTGATTTGGGGTTGGTGGATGGTGGACTGGGGCTTGTTTGCTGATTTTATCAC
TTTGCCTCGCGCGCTCATGTGTTTGGCTGAGTCAATTAACTTAATCAATACTCTAGTCTAGGCAGAAAACCCTAACCCCT
CTGCCCCAACCCCCAAAACTTTTACCCTTTGCCATTAACTTCGCCAGCCAATCAGAACGCGCCAACGCTTTTTAGACAGT
TTTTTTAGACCAAGCCAACCCTAGAGTGAAGCGGCCCGCGGGGTGCGCGCGATTTAGAATAGCCAAACAATTAAATCAGC
CAGTCGCTCTACCCCTCTACCCCCCCCCCCCACCTAACTTTGCACCCAACCGCAGCGCATTATAAAATCCGGTCCGCCCG
GGGCCGCCTTGTACTTTCCCTATTATTATTCTGCGCTGCCTTGCTCTCCCTGCCAATCTATTCTCTGTATTTGATCGTTT
ATTTCTATTTATTTTTGGAAACTTTTAAATCATCGAAGAGATTAACAAGGCACAAAGACATGACTCCACCGCCGCAAGTT
CCCTATATTGGTTCGACAATCTCTCTGCTGTCCAAGGCCAGCATTCGATACGAAGGCTTTCTTTACACTATCGATCAGAA
AGAATCATCCGTAGCCCTATCCCACGTCAAAGTGTTTGGTACAGAGGATCGCCAATGCGACCGTCCAGTGCCGCCGTCCG
ACGAGATCTTCGAATTTATAATATTTCGCGCTTCGGACATCACCGAATTAAAGGTTATCGACACTCCTCCAGTGCGCTCT
GTGCCAGATCCGGCTATTATCCGGGCGCAGAACAAGCCTCCGCCGCAGTCGTCCGATCAACAGCAGCAGTCTAGTACCGC
CGCAACTGCAGAGGCTAATGCATCGGTGAAGAATTTTCTATCGCAGGCTGGCTCTAGCGCAGCTGGAGGCCGCGCCTCGG
CCTTGGCCGTTGGCGGTAGCGGCGGATCAGGAGGCGGCTCTAGCACTGTTCGATTGATGGGCAACTCTAACGGCAGCAGT
CGCAATCAACATTCGTCGCAGCAGCAGCAGCACCAGTCTAGGGGCCAGCAGCAGCCTCTAATGCAAGGCCAGCAGCCATC
CCAACAACAGCAGCAGCAGCAGCAGATGCCGCCTCGTCGTTATAATAACAATCAACAGCAGGATATTAATAAACCATTCT
CTGGCGACTATCAACAGTCTAGGTCATACTACAACAATCGTAGGAACAATGCCGATTTCTTTGACATGCCGCCGTCTGGC
AACAATAGCGGCGGCTATCGAAGCGGAGGCCGTATGGGCCGGTCTGATGGCAACAACGGCTACGGCTATTGTCCGCAGGG
TCCGCCGCCTCTGCAATCGCTGCAGCCGATGCCGCCGCCTCCGCCGCATTATCGCAACGCCTACGGCGGTGGCCCAGGTG
GCTACTCCGGCTATCATCGTCATCAGCAGCAGCATCACCCCGCCGCTGGCGGCTACGGCTATCCGCTGGCACCGCCGATA
ATGTCTATGCCGCCAATGTCTTCGCAGCGGCGCTACGGCGGTCGGCCAGTTATGCACTTTCGGCGCTATCCCGGCGGACC
CGGAATGGGTGGCGGCGGCGGCGGCGGCGGTGGCCGGATGGGCGGTGGCCGCCCCGGTCCATCGCATCATCAACTGGGCG
GCTGGAATTCCGGTGGCAACGATCGACGTCAGCAGCAGCAGCAGCAGCAGCAGCATCACCAGCAGCAGCATCAGCACCGG
CAGCATCTGGTTGATCCGATTCCTGCTCGATTCACTGCCGACTACGATTTCGAAACTGCCAATGCCGAGATGGAGGCCGA
ACTAGCCAAGCTGGTGCTCAACAGCGGCGGAGGTGGTTCTGCCGGGGACAACTCTACAGCGACGGCGGACGCGCCTGCGA
CCTCCGACAATGCTGACACTGACGTCGATTCGAAGGCTCACCTGGCCGGCACCGTGGCGGCTATGGAGTCGCTGCTGCGC
CACGCCCACGCCGGCTATGACAAGGAGAAAAGCTTCTTTGACGACATCAGCCGAGTTGAAGCCGATGCCGCTGCCGATGC
TGCTAATAACTCTAGCGGCTGCGGCGCCGTCAGCTCGGCGCCAGGGCCTAACAACGCCGGCGGCCCTCGAAAGGAAACAT
CGATTCGTCAAAATGCGCTCAACAAGGAGACGTTTGGCCTAGTTGGCGGCCGAATGCGTCGCGGTATTAGCAATCGTTTC
TATGGCAACCGTGGCCCGTATCGCCGAGCTGTTGTGTAGACGGGATTTGGACACACCACAATGTTTTCTGTCGTTGACAA
TTTCTGATCGTCTCGTAAAGCTAAATCAAACAAAGTATGAAAGTCGCGCGTCATTTATTATTACCCTAATTCCTGGCCAA
TATGCTGTTTTTTCGCTAACCGAGTTCTTTGTCGCATTCTTCCCCTTTGTTGATTTATTTCTGCTGCTGCTGCTGAAGCC
AGCCAGGTGTTTTTGCACCTCCCCCTTATCAAATTCGACTCCGACTGCTCGCAGCTTTTGTCATATTGTTCGGCTCCCTT
TTGAAGTTGCTTTTTTATAAAGAGAGACTTGCTTTGCCGCCAGTTCTAAAAGTATGTTTGATACTAATTGTAATAGCAGG
CTTGTTTTTTCGGTCCTTTGATGACAAACAACTCGTCCCGTTTTCTGCGCGATCGTGCGTTTTTGTGACAACTACTTTTC
TCTCGAGCCGCTTTCCTCCAAGGTGTCAGTCTGCACTCCCCCTTATTTTTTTTGTTTATTTGTCGCGCTACAAGTGCGCT
ATCAGAACCCGCTGCTTTGTCGCTATTATCTGTACTAGTTTAGCAAGATTTTCCCGCGGCCAGTTTAAAAGCTATCGCTA
GCGCCACTTTTGAAGTTTCTGCACCGTCATTTTCCTTCACGCTATTGCCCGATATTGATATTGATGAATTTTGCTATCCC
CGTTCAATTTAGTCGCACCGCTGCACAAGATGCAAACGTTTCAAATATTCTGCTATACGATTTCTTCCAAGGAAAAAAGA
ATATTATTATTGATTATTATTTAAGCTAGCAATAAAATCCGAAAGTAATGACGCCTCATTTCATCATTAAATTGCCTTC