>Mlig014003.g6 {REF} Mlig014003.g6 {Length: 3446} {Pfam: Scd6-like Sm domain [PF12701.7, score=93.8]; Ataxin 2 SM domain [PF14438.6, score=29.0]} {Human: ENSG00000257103, LSM14A, LSM14A, mRNA processing body assembly factor, [Score=120, Expect=1e-29]; ENSG00000262860, LSM14A, LSM14A, mRNA processing body assembly factor, [Score=120, Expect=1e-29]; ENSG00000149657, LSM14B, LSM family member 14B, [Score=114, Expect=2e-28]} {Mouse: ENSMUSG00000066568, Lsm14a, LSM14A mRNA processing body assembly factor, [Score=118, Expect=5e-29]} {Dmel: FBgn0041775, tral, trailer hitch, [RH, Score=103, Expect=2e-23]} {Celegans: WBGene00012484, car-1, Cytokinesis, Apoptosis, RNA-associated, [Score=112, Expect=1e-27]} {Smed: dd_Smed_v6_1125_0_1, dd_Smed_v6_1125_0_1, [Score=117, Expect=6e-29]} {Ipul: Ipul034369.g1, Ipul034369.g1, [Score=112, Expect=6e-27]} {RNA1509_1224, RNA1509_244, RNA1509_24782, RNA1509_40925}
GTAAGTTTTTTTAGTTTATTACACCTTTGCTTTGGTTTTGGTTGTGCTTATATCCAACAGGACAAATGTTTTTTAATCAA
CATATTCAAGTTTACCATTCTAGAAATAAATAAATGATTTATCGTCTGCTCAACTTTTTTGTTAATTAGCTTATGTTATT
AAATATTAAAAAGAAATGATATTATTGGTGCGACGAGATATACGCACAGTAAGATGTACTAAAGCTTAAAGGCTTTTCAG
GTCTGGCGTATCAGCAGTAAGGAGAAGGAGGGGATTATGCTATTTTAGCGCCTGCTTTGTTCAGTACGGCGTAGTTAGGT
TGTTTGTGTGTCACGCGGCTAAAGTATTACGTTGCTTTGATTTGGGGTTGGTGGATGGTGGACTGGGGCTTGTTTGCTGA
TTTTATCACTTTGCCTCGCGCGCTCATGTGTTTGGCTGAGTCAATTAACTTAATCAATACTCTAGTCTAGGCAGAAAACC
CTAACCCCTCTGCCCCAACCCCCAAAACTTTTACCCTTTGCCATTAACTTCGCCAGCCAATCAGAACGCGCCAACGCTTT
TTAGACAGTTTTTTAGACCAAGCCAACCCTAGAGTGAAGCGGCCCGCGGGGTGCGCGCGATTTAGAATAGCCAACAAGCC
AAACAATTAAATCAGCCAGTCGCTCTACCCCTCTACCCCCCCCCCACCTAACTTTGCACCCAACCGCAGCGCATTATAAA
ATCCGGTCCGCCCGGGGCCGCCTTGTACTTTCCCTATTATTATTCTGCGCTGCCTTGCTCTCCCTGCCAATCTATTCTCT
GTATTTGATCGTTTATTTCTATTTATTTTTGGAAACTTTTAAATCATCGAAGAGATTAACAAGGCACAAAGACATGACTC
CACCGCCGCAAGTTCCCTATATTGGTTCGACAATCTCTCTGCTGTCCAAGGCCAGCATTCGATACGAAGGCTTTCTTTAC
ACTATCGATCAGAAAGAATCATCCGTAGCCCTATCCCACGTCAAAGTGTTTGGTACAGAGGATCGCCAATGCGACCGTCC
AGTGCCGCCGTCCGACGAGATCTTCGAATTTATAATATTTCGCGCTTCGGACATCACCGAATTAAAGGTTATCGACACTC
CTCCAGTGCGCTCTGTGCCAGATCCGGCTATTATCCGGGCGCAGAACAAGCCTCCGCCGCAGTCGTCCGATCAACAGCAG
CAGTCTAGTACCGCCGCAACTGCAGAGGCTAATGCATCGGTGAAGAATTTTCTATCGCAGGCTGGCTCTAGCGCAGCTGG
AGGCCGCGCCTCGGCCTTGGCCGTTGGCGGTAGCGGCGGATCAGGAGGCGGCTCTAGCACTGTTCGATTGATGGGCAACT
CTAACGGCAGCAGTCGCAATCAACATTCGTCGCAGCAGCAGCAGCACCAGTCTAGGGGCCAGCAGCAGCCTCTAATGCAA
GGCCAGCAGCCATCCCAACAGCAGCAGCAGCAGATACCGCCTCGTCGTTATAATAACAATCAACAGCAGGATAATAATAA
ACCATTCTCTGGCGACTATCAACAGTCTAGGTCATACTACAACAATCGTAGGAACAATGCCGATTTCTTTGACATGCCGC
CGTCTGGCAACAATAGCGGCGGCTATCGAAGCGGAGGCCGTATGGGCCGGTCTGATGGCAACAACGGCTACGGCTATTGT
CCGCAGGGTCCGCCGCCTCTGCAATCGCTGCAGCCGATGCCGCCGCCTCCGCCGCATTATCGCAACGCCTACGGCGGTGG
CCCAGGTGGCTACTCCGGCTATCATCGTCATCAGCAGCAGCATCACCCCGCCGCTGGCGGCTACGGCTATCCGCTGGCAC
CGCCGATAATGTCTATGCCGCCAATGTCTTCGCAGCGGCGCTACGGCGGTCGGGCCAGTTATGCACTTTCGGCGCTATCC
CGGCGGACCCGGAATGGGTGGCGGCGGCGGCGGCGGCGGTGGCCGGATGGGCGGTGGCCGCCCCGGTCCATCGCATCATC
AACTGGGCGGCTGGAATTCCGGTGGCAACGATCGACGTCAGCAGCAGCAGCAGCAGCAGCAGCATCACCAGCAGCAGCAT
CAGCACCGGCAGCATCTGGTTGATCCGATTCCTGCTCGATTCACTGCCGACTACGATTTCGAAACTGCCAATGCCGAGAT
GGAGGCCGAACTAGCCAAGCTGGTGCTCAACAGCGGCGGAGGTGGTTCTGCCGGGGACAACTCTACAGCGACGGCGGACG
CGCCTGCGACCTCCGACAATGCTGACACTGACGTCGATTCGAAGGCTCACCTGGCCGGCACCGTGGCGGCTATGGAGTCG
CTGCTGCGCCACGCCCACGCCGGCTATGACAAGGAGAAAAGCTTCTTTGACGACATCAGCCGAGTTGAAGCCGATGCCGC
TGCCGATGCTGCTAATAACTCTAGCGGCTGCGGCGCCGTCAGCTCGGCGCCAGGGCCTAACAACGCCGGCGGCCCTCGAA
AGGAAACATCGATTCGTCAAAATGCGCTCAACAAGGAGACGTTTGGCCTAGTTGGCGGCCGAATGCGTCGCGGTATTAGC
AATCGTTTCTATGGCAACCGTGGCCCGTATCGCCGAGCTGTTGTGTAGACGGGATTTGGACACACCACAATGTTTTCTGT
CGTTGACAATTTCTGATCGTCTCGTAAAGCTAAATCAAACAAAGTATGAAAGTCGCGCGTCATTTATTATTACCCTAATT
CCTGGCCAATATGCTGTTTTTTTCGCTAACCGAGTTCTTTGTCGCATTCTTCCCCTTTGTTGATTTATTTCTGCTGCTGC
TGCTGAAGCCAGCCAGGTGTTTTTGCACCTCCCCCTTATCAAATTCGACTCCGACTGCTCGCAGCTTTTGTCATATTGTT
CGGCTCCCTTTTGAAGTTGCTTTTTTATAAAGAGAGACTTGCTTTGCCGCCAGTTCTAAAAGTATGTTTGATACTAATTG
TAATAGCAGGCTTGTTTTTTCGGTCCTTTGATGACAAACAACTCGTCCCGTTTTCTGCGCGATCGTGCGTTTTTGTGACA
ACTACTTTTCTCTCGAGCCGCTTTCCTCCAAGGTGTCAGTCTGCACTCCCCCTTATTTTTTGTTTATTTGCCGCGCTACA
AGTGCGCTATCAGAACCCGCTGCTTTGTCGCTATTATCTGTACTAGTTTAGCAAGATTTTCCCGCGGCCAGTTTAAAAGC
TATCGCTAGCGCCACTTTTGAAGTTTCTGCACCGTCATTTTCCTTCACGCTATTGCCCGATATTGATATTGATGAATTTT
GCTATCCCCGTTCAATTTAGTCGCACCGCTGCACAAGATGCAAACGTTTCAAATATTCTGCTATACGATTTCTTCCAAGG
AAAAAAGAATATTATTATTGATTATTATTTAAGCTAGCAATAAAATCCGAAAGTAATGACGCCTCATTTCATCATTAAAT
TGCCTTC