>Mlig032789.g1 {REF} Mlig032789.g1 {Length: 3557} {TRANSSPLICED} {Pfam: DEAD/DEAH box helicase [PF00270.29, score=147.1]; Helicase conserved C-terminal domain [PF00271.31, score=98.2]} {Human: ENSG00000110367, DDX6, DEAD-box helicase 6, [RH, Score=659, Expect=0.0]} {Mouse: ENSMUSG00000032097, Ddx6, DEAD (Asp-Glu-Ala-Asp) box polypeptide 6, [RH, Score=659, Expect=0.0]} {Dmel: FBgn0004419, me31B, maternal expression at 31B, [RH, Score=651, Expect=0.0]} {Celegans: WBGene00000479, cgh-1, ATP-dependent RNA helicase cgh-1, [RH, Score=641, Expect=0.0]} {Smed: dd_Smed_v6_1034_0_1, dd_Smed_v6_1034_0_1, [RH, Score=701, Expect=0.0]} {Ipul: Ipul002558.g1, Ipul002558.g1, [RH, Score=586, Expect=0.0]} {RNA1509_1529, RNA1509_6078}
TTGGACCTTGAATTTGCATTTTATTATCTGTGATCTCGAGTTATTATCTACTCATTTGCTGCATTTATGGAGCGTACTGC
TTCCCAGAAGGGTGATTCCCAGGACTGGAAAGATGGCCTCAAGCTGCCTCCAAAGGATAATCGTCTTCGAACTGTCGATG
TTACATCGACGAAAGGCAATGCTTTTGAGGATTTCAACCTAAAGCGCGATCTTCTAATGGGCATTTATGAGAAAGGATGG
GAAAAGCCATCGCCAATTCAAGAGGCTAGCATCCCTATTGCTCTTACAGGCCGAGACGTCCTCGCCAGGGCCAAGAATGG
CACTGGCAAAACTGGTGCCTACTGCATCCCTCTGCTAGAGAAGATCGACACTAGCAAAAATGCAGTACAATCTATGATAA
TCGTTCCTACTCGCGAGCTTGCTCTGCAAACTAGCCAAATATGTATAGAATTGGCGAAGCACACTGGTGCCAAGATCATG
GTTACTACGGGTGGCACAAATCTTAAAGATGACATCATGCGCCTAGATGAAGAGGTTCATCTCGTAATTGCTACTCCTGG
TCGAGTACTTGATCTTCTTAAAAAGGATGTGCTGAAGACTGATGTTTGCAAAACGTTGGTGCTAGATGAGGCAGATAAGC
TTCTCTCGCAGGATTTTAAGGTAATTTTTTAAATTTGCAAATTTAAGCCTAAACGAGGGTCTGTAATTAAAATTAAAAAG
GCACAGCCTTAGTCCTCACCTCCATCCTGTCCTAGTGTAAGTGATCTTTGATAACTAAAGGTGTGGAAGCATACGCACTG
ACTATAATTATTTATTAATGTTATTAATATATGATGTTACATCTTTCGGGTTTGATACCCTATGAAATCTAGTATATATT
GTCTGAACAAAGTAGTTGTCACTATTAAAAATCTCAATAGATGCCGTGCATTTCAGTTGCGTTCAACCAACTAATACGAT
TTTTATTTTTATTTAGATAATGCTGAGCGGCATCATCTCACGACTGCCCAAGGATCGACAAATTCTCCTGTTTTCCGCCA
CGTTTCCACTCACCGTCCAAGAGTTTATGGAGACTTACCTGCGTACTCCATACGAGATCAACCTAATGGAGGAGCTGACC
CTGAAGGGTATAACTCAGTTCTACGCCTATGTTCAGGAGAAGCACAAGGTTCATTGCCTCAACACTCTGTTCTCTAAGCT
TCAAATCAACCAGTCGATTATCTTCTGCAACACTGCTCAGCGCGTGGAACTTCTTGCCAAGAAAATCACTGAGCTTGGCT
ACTCGTGCTACTACATTCACGCCCGAATGTCGCAACACTTTCGTAATCGCGTCTTCCATGACTTCCGTCAGGGCCACTGC
CGCAATCTCGTCTGCACAGACTTATTCACCCGCGGTATCGACATTCCTTCCGTCAATGTCGTTATTAACTTCGACTTTCC
AAAGTACGCAGAGACTTACCTGCACCGCATTGGCCGCTCTGGCCGCTACGGACACCTGGGCATCGCTATCAACCTCATCA
CGTACGACGACCGCTTTGCTCTTAAACAGATTGAGCAGCAGCTGAACACGGAGATTAAGGCCATCCCCAAGCTGATCGAC
AAGCGCCTGTACGTATCCGAGTACCAGCAGGAAGGCGAGCTAGATGATGAGACCAAGGCTATGCTGGCTTCTGGCAAGGG
CCTCCAGTTCATTCAGGAGCAGCAAACTCTCAATGGGCCGACTCAGTAGCTGAGGCGCGGCGTTGTGTGTAAATAACTTA
CTGTCTCTGTAGTCAACGAATAGTTATGCTGCAGGTGTCCCGTCTGTTCATCATTGAATTGAAACTTTTCCGATATTAGT
AGTAAATAATTGGAGCTTAAAAATGCCTAGCGGACACTTGTGGTGCATCTATTTTTAGACTATTATTTTCTTTTTTGTTG
CCTGTTATAGCTGTATTCGCGTAATTAAATTCGATGATTTTCAATTCTAGTAATACATTTGTAACTTATATCTATGGTTG
GCTGCAGTCTTTCATTGACGCGCTTTGCAATGATGTTTTTGTCTGTTTGAATTGACACGCTGTACCTGTTTGCTTCTATC
TTCCTAATATATTACTACTTTCCAATGCGCTCGTGTTGCGCCTAGATCCCTCTGTACATGTTACGTGCTTTCAGTAGAAC
TAAGCTAAAAGTGACTGCCACCCTGTACAAAATGCAATCCACCATACTATTTGTATAATCCGCATCTTCCTTTTCCTTTC
AATTTCTACGCAACCCAAACAGTGTCCACTAACTTGTGTGCTAATATTACTTGATTACGCGTATTAAATCCTATTTCTCA
TTTCTCAAGAGAATTCTTCCCCTTTGTCCTGAAATAGTGTATTGAATAACATTGTACCTTTGTTTTGTTACTCTCATCAT
CTGCTTCGGCCCCTAATCTTTCCGGTGCAATAACGAATATCTATCTAGCGACCAGTGGCTACCTTATAATGACTATATTT
GCTGCTGTGGTCGTGTCTTGTTAGGCTTCCATGCCTCAAACATGTATTTGTGTGCTCCCAATCTCGTCGCTTCAGTACTT
TGTCCATGACTGTTTCCTGTATTCTTAGTTAATATTTTCTAACTTCATTATTCGATTGAAAGGCGTCCAGGCTTTCAGTT
TCACATCCAGAGCTATTATTCGAATTTTGTGAACAGTCTAGCCACCGTATGCAGCATGGAAATGAATCTTTCACCGTGCC
AGGCATTACATTTGTTAAAATTCTAAATGATGATCCTGTTACAGTAGCCCTTTATTTCCGTACACCCTGTTCTGCAGCAA
CTTGTATCGTATAGAGATGTTTGACCAGTTTATACTTTAATATAACCTGTATTTAACGCAATATTGATAATATTCTGAGC
CAGCTCTTATGTTTCAAGCAAACTCACTATCTACTGCATGCTTTTCACTTGATATCAGCGAGCAAGTCATTCCCAAGTTT
ATTATTAGAGTCTGTCCCATGTCGCATTTGTGGCTTAAGTGGTTTTTGTCCGAACGAGTTCAACGGTGAGCTCATGTGAT
CGCCCAGCTAGCATCGTTTCAAACTTAGACATGTCTCAATCAAAACCGTCTTTGACCACTCCCTTTTGCCATGGAAAGAC
TCCAGTATAACCTACCTACCGCAGTCTAATGTTGTACCGTATATTTATCACTGCCCTACCGATGCTTGTGCTTTTGTCCG
TTTCGGACTATGTTGGCGGCTTGTTGGACTGTATTGATTGACAAATATGCCGGGCAACTAATTTAACTAATATTCTATAC
TAGTATGCTCTGTATGGCCTTAGCCGCGCCAAACTTGCGGGCATAACGCCTGCCATCTGTCAGTTAAATAGCAAATGCAT
TTATACGGTTTTACAACTAAATTACCATCAGCGGCACGGCGTACGATTTTTTTCATATCCACGCATCTACGCTGGATAAA
CTATAACATCTCTTTGTCAGATAAAACTCCAAATTCACTTTTTCGTGTTCAAAATTTTCTTTTTTAATAATAAGCCTATT
TTCTAAAAGTCATTTTTCAGTACCAAAATTCCTTTTTT