>Mlig032789.g3 {REF} Mlig032789.g3 {Length: 3244} {TRANSSPLICED} {Pfam: Helicase conserved C-terminal domain [PF00271.31, score=37.1]} {Human: ENSG00000110367, DDX6, DEAD-box helicase 6, [Score=137, Expect=8e-38]} {Mouse: ENSMUSG00000032097, Ddx6, DEAD (Asp-Glu-Ala-Asp) box polypeptide 6, [Score=137, Expect=3e-38]} {Dmel: FBgn0004419, me31B, maternal expression at 31B, [Score=125, Expect=4e-34]} {Celegans: WBGene00000479, cgh-1, ATP-dependent RNA helicase cgh-1, [Score=125, Expect=5e-34]} {Smed: dd_Smed_v6_1034_0_1, dd_Smed_v6_1034_0_1, [Score=175, Expect=2e-52]} {Ipul: Ipul002558.g1, Ipul002558.g1, [Score=123, Expect=2e-33]} {RNA1509_1529, RNA1509_2093, RNA1509_85}
ATTGGACCTTGAATTTGCATTTTATTATCTGTGATCTCGAGTTATTATCTACTCATTTGTTGCATTTATGGAGCGTACTG
CTTCCCAGAAGGGTGATTCCCAGGACTGGAAAGATGGCCTCAAGCTGCCTCCAAAGGATAATCGGCTTCGAACTGTCGAT
GTTACATCGACGAAAGGCAATGCTTTTGAGGATTTCAACCTAAAGCGCGATCTTCTAATGGGCATTTATGAGAAAGGATG
GGAAAAGCCATCGCCAATTCAAGAGGCTAGCATCCCTATTGCTCTTACAGGCCGAGACGTCCTCGCCAGGGCCAAGAATG
GCACTGGCAAAACTGGTGCCTACTGCATCCCTCTGCTAGAGAAGATCGACACTAGCAAAAATGCAGTACAATCTATGATC
ATCGTTCCTACTCGCGAGCTTGCTCTGCAAACTAGCCAAATATGTATAGAATTGGCCAAGCACACTGGTGCCAAGATCAT
GGTTACTACGGGTGGCACAAATCTTAAAGATGACATCATGCGCCTAGATGAAGAGGTTCATCTCGTAATTGCTACTCCTG
GTCGAGTACTTGATCTTCTTAAAAAGGATGTGCTGAAGACTGATGTTTGCAAAACGTTGGTGCTAGATGAGGCAGACAAG
CTTCTCTCGCAGGATTTTAAGATAATGCTGAGCGGCATCATCTCACGACTGCCCAAGGATCGACAAATTCTCTTGTTTTC
CGCCACATTTCCACTCACCGTCCAAGAGTTTATGGAGACTTACCTGCGTACTCCATACGAGATCAACCTAATGGAGGAGC
TGACTCTGAAGGGTATAACTCAGTTCTACGCCTATGTTCAGGAGAAGCACAAGGTTCATTGCCTCAACACTCTGTTCTCT
AAGCTTCAAATCAACCAGTCGATTATCTTCTGCAACACTGCTCAGCGCGTGGAACTTCTTGCCAAGAAAATCACCGAGCT
TGGCTACTCGTGCTACTACATTCACGCCCGAATGTCGCAACACTTTCGTAATCGCGTCTTCCATGACTTCCGTCAGGGCC
ACTGCCGCAATCTCGTCTGCACAGACTTATTCACCCGCGCGTATCGACATTCCTTCTGTCAATGTCGTTATTAACTTCGA
CTTTCCAAAGTACGCAGAGACTTACCTGCACCGCATTGGCCGCTCTGGCCGCTACGGACACCTGGGCATCGCTATCAACC
TCATCACGTACGACGACCGCTTTGCTCTTAAACAGATTGAGCAGCAGCTGAACACGGAGATTAAGGCCATCCCCAAGCTG
ATCGACAAGCGCCTGTATGTATCCGAGTACCAGCAGGAAGGCGAGCTAGATGATGAGACCAAGGCTATGCTGGCTTCTGG
CAAGGGCCTCCAGTTCATTCAGGAGCAGCAAACTCTCAATGGGCCGACTCAGTAGCTGAGGCGCGGCGTTGTGTGTAAAT
AACTTACTGTCTCTGTAGTCAACGAATAGTTATGCTGCAGGTGTCCCGTCTGTTCATCATTGAATTGAAACTTTTCCGAT
ATTAGTAGTAAGTAATTGGAGCTTAAAAATGCCTAGCGGACACTTGTGGTGCATCTATTTTTAGACTATTATTTTCTTTT
TTGTTGCCTGTTATAGCTGTATTCGCGTAATTAAATTCGATGATTTTCAATTCTAGTAATACATTTGTAACTTATATCTA
TGGTTGGCTGCAGTCTTTCATTGACGCGCTTTGCAATGATGTTTGTCTGTTTGAATTGACACGCTGTACCTGTTTGCTTC
TATCTTCCTAATATATTACTACTTTCCAATGCGCTCGTGTTGCGCCTAGATCCCTCTGTACATGTTACGTGCTTTCAGTA
GAACTAAGCTAAAAGTGACTGCCACCCTGTACAAAATGCAATCCACCATACTATTTGTATAATCCGCATCTTCCTTGTCC
TTTCAATTTCTACGCAACCCAAACAGTGTCCACTAACTTGTGTGCTAATATTACTTGATTACGCGTATTAAATCCTATTT
CTCATTTCTCAAGAGAATTCTTCCCCTTTGTCCTGAAATAGTGTATTGAATAACATTGTACCTTTGTTTTGTTACTCTCA
TCATCTGCTTCGGCCCCTAATCTTTCCGGTGCAATAACGAATATCTATCTAGCGACCAGTGGCTACCTTATAATGACTAT
ATTTGCTGCTGTGGTCGTGTCTTGTTAGGCTTCCATGCCTCAAACATGTATTTGTGTGCTCCCAATCTCTTCGCTTCAGT
ACTTTGTCCATGACTGTTTCCTGTATTCTTAGTTAATATTTTCTAACTTCATTATTCGATTGAAAGGCGTCCAGGCTTTC
AGTTTCACATCCAGAGCTATTATTCGAATTTTGTGAACAGTCTAGCCACCGTATGCAGCATGGAAATGAATCTTTCACCG
TGCCAGGCATTACATTTGTTAAAATTCTAAATGATGATCCTGTTACAGTAGCCCTTTATTTCCGTACACCCTGTTCTGCA
GCAACTTGTATCGTATAGAGATGTTTGACCAGTTTATACTTTAATATAACCTGTATTTAACGCAATATTGATAATATTCT
GAGCCAGCTCTTATGTTTCAAGCAAACTCACTATCTACTGCATGCTTTTCACTTGATATCAGCGAGCAAGTCATTCCCAA
GTTTATTATTAGAGTCTGTCCCATGTCGCATTTGTGGCTTAAGTGGTTTTTGTCCGTACGAGTTCAACGCTGAGCTCATG
TGATCGCCCAGCTAGCATCGTTTCAAACTTAGACATGTTGTCTCAATCAAAACCGTCTTTGACCACTCCCTTTTGCCATG
GAAAGACTCCAGTATCACCTACCTACCGCAGTCTAATGTTGTACCGTATATTTATCACTGCCCTACCGATGCTTGTGCTT
TTGTCCGTTTCGGACTATGTTGGCGGCTTGTTGGACTGTATTGATTGACAAATATGCCGGGCAACTAATTTAACTAATAT
TCTATACTAGTATGCTCTGTATGGCCTTAGCCGCGCCAAACTTGCGGGCATAACGCCTGCCATCTGTCAGTTAAATAGCA
AATGCATTTATACGGTTTTACAACTAAATTACCATCAGCGGCACGGCGTACGATTTTTTTCATATCCACGCATCTACGCT
GGATAAACTATAACATCTCTTTGTCAGATAAAACTCCAAATTCACTTTTTCGTGTTCAAAATTTTCTTTTTTAATAATAA
GCCTATTTTCTAAAAGTCATTTTTCAGTACCAAAATTCCTTTTTG