>Mlig039975.g1 {REF} Mlig039975.g1 {Length: 6373} {Pfam: RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) [PF00076.22, score=281.2]; Poly-adenylate binding protein, unique domain [PF00658.18, score=106.5]; RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) [PF13893.6, score=41.7]; Nup53/35/40-type RNA recognition motif [PF14605.6, score=33.7]; RNA binding motif [PF08777.11, score=24.9]; Protein of unknown function (DUF4523) [PF15023.6, score=22.9]; RNA recognition motif [PF16367.5, score=22.5]; Occluded RNA-recognition motif [PF16842.5, score=19.1]} {Human: ENSG00000090621, PABPC4, poly(A) binding protein cytoplasmic 4, [RH, Score=737, Expect=0.0]; ENSG00000070756, PABPC1, poly(A) binding protein cytoplasmic 1, [RH, Score=717, Expect=0.0]} {Mouse: ENSMUSG00000011257, Pabpc4, poly(A) binding protein, cytoplasmic 4, [RH, Score=729, Expect=0.0]; ENSMUSG00000022283, Pabpc1, poly(A) binding protein, cytoplasmic 1, [RH, Score=718, Expect=0.0]} {Dmel: FBgn0265297, pAbp, poly(A) binding protein, [RH, Score=669, Expect=0.0]} {Celegans: WBGene00003902, pab-1, Polyadenylate-binding protein, [RH, Score=665, Expect=0.0]} {Smed: dd_Smed_v6_11729_0_1, dd_Smed_v6_11729_0_1, [RH, Score=725, Expect=0.0]} {Ipul: Ipul008508.g1, Ipul008508.g1, [RH, Score=584, Expect=0.0]} {RNA1509_114}
CAAAAACTAAATACTAATGTGACAAGCTTTGACTGGGGCTACGTTATGTCCCCCTGTACCGGGAGTGACGTGAACATTGA
TACGAACAGTAAGAACATTTCCTAATATTTTGTTGTGAAAGAGTCGAGGCGAGAACATACGCTATAGTGTTATCAGAGGC
TGTTTAGCATGTCGTAACGTTTCAAACAATGACACGTGATGGTCGGTCACGGAACAAAGCGGTCGGGGGCCCGTCGCCGG
CGATTGGTTCGACGTGGGGATGCGCCTGAAGACTCAGCAGGGGCCACCGGGTCTTCCTGACGGCCGGTTGTGCTTTCGGG
CTGCGTTTCCGGGTCCGCATCTGTCGCATTCCCGGAGCTATCAGCGGCATCCTCCTCCGGATCCTGGTTCGGGTCTGGTG
CTAGCTGGTTGGTACTGGCGAGGCGCAAGTTATCTCCATCGCAAATCCAAGCGGTGTTGCGGCCTTGGTGCAGGACGTAC
TCTACACGTTTAGGCAGCTCATCGTTGGTCAAGTGATACAGCACGCTTTCACCTTGCTGGAATGGCGAGACCGTACAGGG
ACTCGGATTGGCCGACCGAAGACCAACTCGGCCGGGCTCTTTCCACGAGTGTGCGACGAAACTCGGTGGTGCAGCAGAAC
TCTCTGTAAAAACGGAGTGAACTCTGCGTGGGTTATGCGATCATCCCAGGCACGCAGGGCGCGCTTGACAGTTTGCACGG
CCAGTTCGGCGGCTCCATTAGCCTGGGGGTAATATGTTGGCGATTCGAGTTTGCGAACCCCGTTTGCCTTTAGCCAGAGG
CGCACTGGGTCGCTAGTAAACTCTGGAGCATTGTCGGAGACCAGCAACTCAGGGATTCCGAAACGAGTGAATACGGTTCG
AAGCGATGAAATTACAGATTTTGAGGAGCGATCCTTGCATGGAAACGCTTCAATCCATCCTGAGAAAGTATCGACGCTTC
GTTGTACAAAGGCCCACTCCTTATGCAGTTTTTGGAAAGCGTACTCGGCAGATGGCCATGCGTGTCGTTCTGGTGATAAT
CTTGGTCGCAACTGATTGCAGATCGGACAGTTACGGACGAAGCGTTCAACATCTGCGCGCATTCCTGGCCACCAGCAGGA
CAAGGCCATGTAATTGTAGGCGGAGATGTAGCCTGAGTGGGCGGTGTGCAGTGCGGAATGCCTCGGCTCTCAGCGTGATG
GAATAAATATGCGACGCCCATAAACAAGTAGACCACCTTCAATGGTGAGGCTGTCAGAAACCTTAGCGAAGGGTCTTTCC
GCCTGAGAGCAGCCCGTCGACCTTCCAGTTTTAACGCGATTAATTACGCTCTGAATAACTGGACCCATCTCCAATTCTGC
TAGAATGCGGTGCTGTGGTACCATGAGCGTCTCAAACGCGACGCAGTTTATAGCATCGGACAGCTCTGCCGTATCTGCCG
ATGGGTCAGTAAAGCGTAAACGAGACAGAGCGTCTGCGTGAGGTATTTTGGACCAGGGCGTGTATTGATTTTAGTAGTCA
TAGTGCTTCATTGCAAATGCCCATCTCGAGATGCGAACAGATGTGTTGGTGGGCACGCCATGCGACTGGCCAAACAAACG
AATCAGAGGTTGGTGATCTGTCTGTATGGTGAATTTTCGGCCCATGAGATAATGCTTGAGGCGATTGACGGCCCAGAATA
TGGCCAGCGCTTCCCGTTCGATGTTCGCATAGTTCTTTTCAGCGCTGGACAAACAACGAGATATGAATATTACTGGGTGA
CGTCTTGCGTGACGACGCCGGCAAGTGCACCTTTAGAGGCATCAGTTGTGAGCGATAACTCCTCTAGCGAATATGGCTGG
ACCACAGGTGCCGACGAGATTGATCCTTTTTAACGCTATAAACGCTTTATCGCACTCGGCTGACCAAACAAATGTGGCGT
CATCACGCCGGAGGTTATGTAGGCACTTCGTTTTGCCAGCAAAGTTTGGGACCAGCCGGCCAAAGAAATTAACTAGACCG
AGAACCTGCTCCAGTTCCTTGCGGTTTGAAGGCGTGGCTATGTCCAAGATCTTCTTGACGATAATTTTGACGTGGTTATG
TAATTAGAATTACATGCATAAATAACGGACTCGTTCAACAAAATAAAATCGCTTTTGCCCAAAAGTACCTCTTGGGCCAG
TATGCATTGTTGGCGACAGTTCAACTTCCGATTTTTCCTGCTCCGAGTTCTCCCGACTTTCAATGCAACTAAATTCTTAA
ATAGTGACTTTGAGTTGTTCGATTCGTGCTCAATTCCACACCCAGCTTCTTTCGGGTCATCCACAACCACCAAAATTTTC
CTCCTCTGACATTCAAGCTTTTCGTGCACTACCACATCCCCCAATTTCGAGATATTTGATCCCACAAACGAAGGTTTCTA
ATAGTAAGTCTGGTCGCACTCTATTCTTCGACCCTTATTGTCGAATCTGAAGCTACTTTGGACGTGATTAGAGTATTAAA
GAAAATATAAAAAAATTGAAAAAAGTTTTCTACCAGTGTTTGGAACTACTACTAACTTCAATTGACCAAAATGGCCTTGC
CAAGCAACCAAGCCCAAGGAGTGGCTACAGGTGGTGGTCAGCCAAGCTCTTACCCCATGGCTTCATTGTATGTGGGTGAT
CTTCATCCAGAAGTAACCGAGGCGATGATATTCGAGAAGTTCTCTCAAGCTGGTCCTGTTCTATCCATTCGAGTATGTCG
TGATATGATCACTCGCAAGTCCCTGGGCTATGCTTATGTTAACTTTCAACAGCCTGCTGATGCCGAGCGCGCTTTGGACA
CGATGAACTTCGATCCGATGAAGGGGCGCCCGATTCGCATCATGTGGTCTCAGCGAGACCCGTCCTTGCGCAAGTCGGGA
CAAGGCAACATCTTTATTAAGAATTTGGACAAGCAGATTGACAACAAGGCCATGTTCGACACATTCTCGGCCTTTGGCAA
CATTTTGTCTTGCAAAATTGCTAATGACGAGACTGGCAACTCGCGCGGCTACGGCTTTGTGCACTTTGAGACTCAAGAGG
CCGCCGACCAGGCTATCGAGAAGGTCAACGGTATGCTTCTGGCTGGCAAGAAAGTCTTTGTAGGCCCATTCGTGCCGCGC
AAGGAGCGGCACAGCAACAGCAGCGATAAGAAGTTTACCAACGTGTTTGTTAAGAACTTTGGCGACGAGCTCACTGAAGA
GAGTTTTCACACCATGTTCTCGGAGTTCGGCGAGATCACCTCGTCCAGGGTGATGTTAGACGAGACTGGCAAAGGCAAAG
GATTTGGCTTCGTCTGCTTCAAGGAGCCAGAGTCGGCCGAGGCCGCCGTATCCGCGCTGAACGGCAAGGAGATCAACGGC
AAGACTCTCTACGTCGGCCGGGCCCAGAAGAAGGGCGAGCGACAGGCCGAGCTTCGCGAGAAATTCGAACGCCAGAAGCA
GGAGCGAATGAATCGCTACCAGACTGGCGTTAATCTGTACGTGAAGAATCTGGATGACACCATTGACGACGAGAAGCTGA
AGGCCGAGTTCGCCTCATTTGGAAACATCACGTCTGCCAAGGTAATGATTGATTCAACTGGTCGCAGCAAGGGCTTCGGG
TTCGTCTGCTTTGTAGCGCCCGAGGAGGCCACTAAAGCCGTCACCGAGATGAACGGCAAAATCGTAGTCAGCAAGCCTCT
GTACGTGGCCCTAGCCCAGCGCAAGGAGGACCGCAAGGCTCACCTGGCCTCGCAGTACATGCAGCGCCTAGCCAGCTATC
GCATGCAGGGCCAGCTGCCCAGCCAGTTCATGCCGCAGGCCCAGGCTCCTGGCTACTTTGTACCAACAATGCAGCAGCCG
CGCAATTTCTTCAACCCCATAGCCGGGATGAACATGAACATCCAGCGCCCGCCGCCGCAGCGCTGGGGCACCGCTGGCCA
GCCTAGCGGACAGCCAATCCGTCCGGCCCAGTACGGTGGCCCGGCCGGTCCCCAGGTGCCGGCCATGCAGCCTCAGCCAG
CCGGCCTGGGCGCTCGTCCTCAGCGTCCTGCCGGAGTGCCTCAGGCCACCATCCGGCCGACCTCGCGGCCCATCACCAAC
CAACAGGGCCCGATGCCGGCTGGCCGCCCGATGCCCAACACTGTTGGCCGTCCCGGCGGCGTCATTCCGCCGCAACAGCA
GATGGGCGTCCCCGGCGGTCCGCGCAAGCCGGCGCCCAACTATCAGATTAACCCGATGGCGCGCAACGTTGTGGCCCCTG
GCGGCTACGGCCAGCAGGCTGTCGCTGCCCAGATGCAGCAGCAGGCTCAGGGCCAGCTGTCTCATCACGATCGTGTGCCC
GGCGCTCAGGAGCCGCTGACTACCGCTATGCTAGCCGCCGCCCCGCCGCAGGAGCAGAAGCAGATGCTTGGCGAGAGGCT
CTATCCGCTAATTCACGAGATGCACTCCCAGCTGGCTGGCAAGATTACCGGTATGCTGTTGGAGATTGACAACGCCGAGC
TGCTGCACATGCTGGAGTCGCACGATGCGCTCAAGTCGAAGGTGGACGAGGCCGTGGCCGTTCTGCACGCCCACCAGGCC
AAGAGCCAGGCCACCGGCGGCCAGCAGTCCGGCGCCGCCCAGGCCGCGGCCGGCGAGAAGCAGAACTAACTTGTGAGAGA
AAAGAATCGAACGAATCGCCCTACAATGCAGTGAAACTTGGTCAAGACCGTTTGAAAATTGTCTGCGTCATCTGAAGGAC
TTAGTAGTTTCTTTTAGTAAGTTTTCTTTTCCAAACGGAGACCCTCCAAACCCTGGTTGCAAAGCTCGTTAACGTTTCAA
TAAAAAAATGGACTCACTATATGCTCCCAGTTTACGTCCGAATTTTCTATCAGCTCTTCGTATCGCTCATAATAAGCTCT
CATGTTTCGTTGCTATGGCAACAGCTTTCATCTCGCACGGCTGTTTTAGTCGTGCGTGTCATCATCGCGCGTTTTCTATT
CGAAAAAAACGGTTGGCGCACTAGCCTTCAGAAGACTGACAGCCTTTAGAAACTGCTATTTATTAGATCTAATAAGTAGA
TAATAAGGCACAGACGATACAAACACAAGTCTGTCAACTCTGTCGGCCGTGCGCTAGCTTACAAAAAAATAGCAAAAACT
GTTTTTTCGGGTGCGTTTGATCCGATAACCCCCAGTAACTCAAATCCAAAAAAAAATGTTTTTTTTGTTTCCGAAAAAGA
ACGACTAGTAGAAGTTGGAGATGTGCTTTCATCTGCCGCCGAAGTTGTGCCGGAGCGCCGCCGCCGCTTCAAATCAGATG
CCGGATTTGGTGGTTCATTTTTCTGTGTCCCCAACCAAGTCCCGGCTTGTGTTCCGATGGCTATATTATAAAATACTAAC
CTGTTTCACTTTCCGTTCTGTCCCGAGTTTTTTCCGTTGTCTTTTGTTTTTTTAAAGCATATTTGTTTAGTTAATACGGC
GCTTGCAAATGCCGCGGGTTGTGCTTTGATTGGCTGCTCTGGCGGACTTTGTACGAGCTACTTTACTAACAGCAGCGTTT
GCAAGTGCTTAAAAACTGCACTAATCATTATAACCTTTGGACACGGCCTCTTGTTTTTTTATTTTTAAACTCAGAAATCC
AATCCAACTCGAAATTTTATTTATTTATTTTTTGTTCAAGTTCCGTGATCCGTGCTAAGCGTTGTTTAAAAAAAACTACA
CTATTTATTTGAATAGGGACAAAAAAAGGTTATTGTACTCGTAAAGGCGCAGTACAGGTGGGATTATATCGCCTATTATT
ATATACCAGCGCTCCTATTTTAGCATATAAAAGTTATTATTAAAGCCCGCAAAAGACAGGTCTGTTTACCACCAGTCGAA
AAAAACATATTGCTAGATTGAAGTTTATCCTCGTGTTATTTTTAAGACAAGCTTTTAATGCAGAATTTATTTCGCTCTGC
CGGCGTCAGTCTTCTATTACTATTATCGTTTGTGTTTCACTTTACTTTATTATTATTTAAAAAAAATAATATTCAAGTCC
GACAGTTCCTGAAAGTTGATACAAACTACCTATAAACTGTTTGTCTCATACCTGCAACCTTATTCCACTGGCCTTGTGTG
CTCCGCTCTCAAAGCCGGAGACAGCTTTTGTGTTTGCTTTTTGGCGCACGATTATTCTAGCGAGTAAAGAAGGACTTGCT
TGCCTTCCCCCTTGGCCGAATCTTTATTTTAAGCCGCGTTCAATCACTCGCCGTTTGTTTTTTGGGTGTGTTCTCGTTGT
TACACAGTTATAGACAATTTAGTACATTACAACAGCAGGCAGCGAAGGAGAAGGCTAAGGAAATAAAAGGGCGATTCGTC
TTTTTGCAAGACAACCGACATCTTTTGAAAACTATAATAATGGTTACAAAAAAG